Aller au contenu. | Aller à la navigation

Outils personnels

Plateforme - ACCES
Navigation

Enseigner les Sciences de la nature

logo ensl   Logo du ministère de l'éducation
logo CIRI logo Immuniser Lyon
logo LBMC logo Musée Mérieux
Logo Inserm igfl igfl logo CREATIS
Logo du Museum national des histoires naturelles
Logo du musée de Confluences
logo geo 3d
Logo de Lyon 1 logo lgltpe 
Logo du Museum national des histoires naturelles
Logo du musée de Confluences
logo LBMC
logo LBMC
logos composé logo COP In My City logo Investissement d'avenirLogo du musée de Confluences
logo Météo France Logo du musée de Confluences
logo EVSlogo Grand Lyon
logo UDL
Logo Auvergne-Rhone-Alpes
logo UNISCIEL

Une différence phénotypique associée à une différence d’expression d’un gène : exemple du gène agouti chez la souris

Par salame — Dernière modification 24/12/2017 10:08

Une différence phénotypique associée à une différence d’expression d’un gène : exemple du gène agouti chez la souris

 

A – Des différences phénotypiques

Une souris jaune femelle  est apparue en 1960 dans un élevage de laboratoire de souris grises. Depuis, à partir de cette souris initiale, les chercheurs ont créé une souche de souris jaunes de lignée pure. Les souris jaunes de cette souche diffèrent des souris grises sauvages, non seulement par la couleur du pelage mais aussi par d’autres caractères : obésité, forte fréquence de diabète et susceptibilité au cancer, notamment.

Souris obèse.jpg

B – Déterminisme génétique de ces différences phénotypiques

1 – Dans la publication relatant l’apparition de cette souris jaune mutante (A new viable yellow mutation in the house mouse), M. Dickies  indique que cette souris jaune femelle croisée avec des souris grises mâles a donné naissance à 18 descendants dont 10 étaient jaunes et 8 gris.

2 – Les chercheurs ont réussi à identifier le gène en jeu qu’ils ont appelé gène agouti. Ils ont déterminé sa séquence. Avec Anagène, on peut comparer les séquences codantes des allèles du gène agouti chez des souris grises et jaunes homozygotes pour ce gène. Ces deux allèles sont représentés par les symboles suivants : A pour souris grise ; Avy pour souris jaune.

Fichier Agouti souris grise –souris jaune.edi.

3 – Les allèles A et Avy codent pour une protéine de 131 acides aminés. celle-ci est synthétisée dans les cellules dermiques de la peau et sécrétée dans le milieu interstitiel de la peau. Elle agit sur les mélanocytes de la peau et des follicules pileux en se fixant sur des récepteurs membranaires (appelés MC1R) des mélanocytes, cellules qui synthétisent les pigments de la peau appelés mélanines. En l’absence de la protéine agouti, les mélanocytes, sous l’action de leurs récepteurs MC1R, synthétisent uniquement une mélanine de couleur brune à noire, l’eumélanine. Cette production d’eumélanine est augmentée par une hormone, (MSH) qui se fixe aux récepteurs MC1R. La protéine agouti en se fixant sur les récepteurs MC1R inhibe la production d’eumélanine et fait que les mélanocytes produisent aussi un pigment jaune appelé phéomélanine. La figure suivante schématise ces données.

Schéma-MC1R.jpg

4 – Les chercheurs ont aussi étudié l’expression de ce gène agouti dans la peau des souris grises et jaunes ainsi que dans d’autres tissus en utilisant la technique du Northern blot. Le principe de cette technique consiste à extraire l’ARN d’un tissu, à réaliser une électrophorèse sur gel d’agarose de cet ARN global afin d’en séparer les divers constituants, à transférer les ARN ainsi séparés sur une membrane puis à visualiser l’ARN recherché grâce à une sonde marquée qui s’hybridera spécifiquement avec cet ARN.

La figure suivante illustre les résultats obtenus chez la souris jaune et la souris grise.

 

Electrophorèse agouti.jpg

Identification des ARNm par Northern blot.

Adapté d'après Duhl DM et al. Neomorphic agouti mutations in obese yellow mice. Nat Genet. 1994 Sep;8(1):59-65.

B : cerveau ; Sp : rate ; K : rein ; Li : foie ; Lu : poumons ; Sk : peau.

5 - Les chercheurs ont alors identifié une différence dans la séquence qui contrôle l’expression du gène, séquence dite régulatrice située en amont du début du site de transcription du gène agouti.

ISchema gène agouti.jpg

 En bleu le début de la transcription de chaque allèle. En amont la zone régulatrice de l'expression du gène. IAP désigne une séquence nucléotides ci dessous :

GGCACCAATTGTTATTCGACGCGTTCTCACGACCGGCCAGGAAGAACACCACAGACCAGAATCTTC

TGCGACAAAGCTTTATTCTTACATCTTCAGGAAAAGAGAGCAAGAAGCAAGAGAGAGAGAAAAACGAA

ACCCCTTCTATTTTAAAGAGAACAACCATTGCCTAGGGCGCATCACTCCCTGATTGGCTGCAGCCCAT

GGCCGAGCTGACGTTCACGGGAAAAACAGAGTACAAGTGGTCGTAAATACCCTTGGCTCATGCGCAG

ATTATTTGTTTACCAACTTAGAACACAGGATGTCAGCGCCATCTTGTGACGGCGAATGTGGGGGCGGC

TTCCCACA